anyone help me solve my assignment ?

Hi everyone , i'm newbie of JAVA so , i have a lot of thing wanna ask , please help me . this is my assignment :

[size=large]Question 2—Nucleotides[/size]

DNA can be considered the source code of life1. It contains the instructions for (most of the) life on
Earth. Unlike digital computers that use binary to encode information and instructions in 1s and 0s, DNA
has four possible nucleotides: Adenine, Cytosine, Guanine, and Thymine, represented by A, C, G and T,
respectively.
Bioinformatics is field of study that applies concepts from computer science and statistics to study
molecular biology using computer software and hardware.
Biologists and bioinformaticians typically store genetic databases of DNA in a text‐based file format
called FASTA2. The FASTA file format is relatively simple:
• Each FASTA‐formatted file starts with a header line. The first character on a header line is
always the greater‐than character (‘>’),
• The header line is followed by lines of sequence data (As, Cs, Gs, and Ts), with 80 (or fewer)
characters per line.

Example3:

Code:

---

>gi|21071042|ref|NM_000193.2| Homo sapiens sonic hedgehog (SHH), mRNA
GCGAGGCAGCCAGCGAGGGAGAGAGCGAGCGGGCGAGCCGGAGCGAGGAAGGGAAAGCGCAAGAGAGAGC
GCACACGCACACACCCGCCGCGCGCACTCGCGCACGGACCCGCACGGGGACAGCTCGGAAGTCATCAGTT
CCATGGGCGAGATGCTGCTGCTGGCGAGATGTCTGCTGCTAGTCCTCGTCTCCTCGCTGCTGGTATGCTC
GGGACTGGCGTGCGGACCGGGCAGGTTCGGGAAGAGGAGGCACCCCAAGCTGACCCCTTTAGCC
TACAAGCAGTTTATCCCCAATGTGGCCGAGAAGACCCTAGGCGCCAGCGGAAGGTATGAAGGGAAGATCT
CCAGAAACTCCGAGCGATTTAAGGAACTCACCAATTACAACCCCGACATCATATTTAAG

---

Write a program that will

• read a file containing one FASTA formatted sequence record,
• count the number of each of the four nucleotides (A,C,G and T) per sequence in the record, and
• print a histogram displaying the genetic make‐up of the sequence record.

Input: Use JFileChooser to prompt the user to select a FASTA formatted file, and use Scanner to read
the file selected by the user. The FASTA formatted file selected by the user will contain at least one
sequence record, but may contain more than one. Assume that the file chosen by the user will meet the
standard FASTA file format described above, and that the sequence data will be all upper case
characters.

Code:

---

[b]File input with JFileChooser and Scanner[/b]

So far in the course you’ve used Scanner to get input from the user with the keyboard. In some
situations, getting input from the keyboard is cumbersome (entering 1000 bases, for example).
To use [b]JFileChooser[/b] your program must add a couple of import statements to the regular import
statements:

---

Code:

---

import java.io.File;
import java.io.FileNotFoundException;
import javax.swing.JFileChooser;
You’ll also need to insert and use the following static method:
/**
* Prompt the user to select a file using JFileChooser and return
* the File object that the user selected.
*
* @return the file selected by the user
*/
public static File getFile() {
JFileChooser chooser = new JFileChooser();
File fastaFile = null;
int returnValue;
// show the open file dialog
returnValue = chooser.showOpenDialog(null);
// check to see that the user clicked the OK button
if (returnValue == JFileChooser.APPROVE_OPTION) {
// get the selected file
fastaFile = chooser.getSelectedFile();
}
return fastaFile;
}
So far we’ve been using Scanner by passing System.in to get input from the keyboard:
Scanner keyboard = new Scanner(System.in);
Scanner can also be used to read the contents of a file. Simply replace System.in with an
instance of a File variable (like the one returned by getFile()):
Scanner fileReader = new Scanner(aFile);
Finally, you must surround any code using a fileReader instance of Scanner using a try/catch
block. Try/catch blocks are used in Java to deal with possible runtime exceptions. In the case of
reading files using Scanner, we have to deal with a possible FileNotFoundException – an
exception that may occur if the user typed in a file name that did not exist.
Example:
try {
Scanner fileReader = new Scanner(aFile);
// your code working with fileReader goes here
} catch (FileNotFoundException e) {
e.printStackTrace();
}

---

Methods: In addition to the getFile() method, your program must implement and use the following
static methods:

Code:

---

public static void main(String[] args)

---

Your main method should prompt the user to select a FASTA file using the getFile() method.
Then, the main method should pass the file to getHeader() and getSequence() to get the header and
sequence from the FASTA file. Next, the main method should call countBase() for each of the four
different types of bases and determine the percentage of the entire sequence that each base

represents. The percentage should be rounded to the nearest whole number. Finally, the main method
should call printDNAHistogram() to print out the histogram representing the statistics of the file.

Code:

---

public static String getHeader(File fastaFile)

---

Using Scanner, the getHeader method should read the first line contained in fastaFile
(which is the header line of the record). This method should remove the leading ‘>’ character before
returning the header line.

Code:

---

public static String getSequence(File fastaFile)

---

Using Scanner, the getSequence method should skip the first line contained in fastaFile
(which is the header line of the record) and store any subsequent lines (the sequence data) until the
Scanner has no more lines left. The getSequence method should use the hasNextLine() and
nextLine() methods from the Scanner class to read the sequence from the file. Once the Scanner
has no more lines remaining, the getSequence method should return all of the data that it stored.

Code:

---

public static int countBase(String sequence, char base)

---

The countBase method accepts sequence data (a String containing only As, Cs, Gs, and Ts),
and a specific base character to count. The countBase method should return the number of times
that base occurred in sequence.

Code:

---

public static void printDNAHistogram(String header, int aPct, int
cPct, int gPct, int tPct)

---

The printDNAHistogram method should print out the histogram for the result calculated by
other methods. The printDNAHistogram method should first print out header, and then it should
call the printBar method (described below) for each of aPct, cPct, gPct, and tPct.

Code:

---

public static void printBar(String label, int percent, char barSymbol)

---

The printBar method should print out a single bar for a histogram. The printBar method
should first print out label. Then, the method should print out percent copies of the symbol
barSymbol. Finally, the method should print out the actual percentage that the bar displays. All of
this information should be on the same line.

For example, the call

Code:

---

printBar("A",25,'=');

---

would print out the following line:

Code:

---

A: ========================= (25%)

---

Output: Use System.out for all output. For the sequence record in the file, print:

1. The header line (without the leading ‘>’), and
2. A histogram showing the percentage of As, the percentage of Cs, the percentage of Gs, and the
percentage of Ts.

Using the example sequence from above, an execution of your program would look like this:

Code:

---

gi|21071042|ref|NM_000193.2| Homo sapiens sonic hedgehog (SHH), mRNA
A: ========================= (25%)
G: ================================= (33%)
C: ============================= (29%)
T: ============== (14%)
Programmed by [your name here].
End of processing.

---

Hand‐in: Save your file using the naming conventions described in the beginning of the assignment.
Upload your file using the web‐based hand‐in tool. Also, submit the output for the two FASTA files
provided on the course web page.

PDF file :

Code:

---

http://www.mediafire.com/?trgt46rb81n1g8h

---

I get stuck at this point when filling out at (while loop) ,any one help me

Code:

---

import java.io.File;
import java.io.FileNotFoundException;
import javax.swing.JFileChooser;
import java.util.Scanner;

// name of class.
public class QuangNguyenA3Q2 {
        public static void main (String[]args) {


                try {
                Scanner fileReader = new Scanner(getFile());

                // code working with fileReader goes here

                int A;
                int C;
                int G;
                int T;
                char x;

                while () {

                        if( x == 'A') A++;
                        if( x == 'C') C++;
                        if( x == 'G') G++;
                        if( x == 'T') T++;
        }

                } catch (FileNotFoundException e) {
                e.printStackTrace();
}

        }

        public static File getFile() {
                JFileChooser chooser = new JFileChooser();
                File fastaFile = null;
                int returnValue;

        // show the open file dialog
                returnValue = chooser.showOpenDialog(null);

        // check to see that the user clicked the OK button
                if (returnValue == JFileChooser.APPROVE_OPTION) {
        // get the selected file
                fastaFile = chooser.getSelectedFile();
                }
                return fastaFile;
        }
}

---

Quote:

---

Your main method should prompt the user to select a FASTA file using the getFile() method.
Then, the main method should pass the file to getHeader() and getSequence()...

---

Why are you not doing what the assignment told you to do?

The instructions were quite clear about what should go in the main() method and that while loop wasn't mentioned.

The order given in the instructions is a pretty decent way to attack this problem. So start by

(1) Using getFile() to obtain the file to use

(2) Then calling getHeader() - which you will have to write - to obtain the header line.

(3) Then print that header line.

(The last step is not actually in the instructions but it's clear from the example at the end)

---------------------

Some techniques that I find useful:

* have a clear plan. The assignment instructions provide this. Don't ignore them.

* compile. compile. compile. Compile after every line or block of code if need be. If you can't understand a compiler message post it here and someone will explain. But do not let them accumulate.

* Test as often as you can. Once you get to the third step above you can test what you have so far by running the program with your test data and checking the header. (You can also add other stuff that you print just to check what's going on, then remove it before you hand the assignment in) If your tests fail - the header line isn't right, or doesn't print or the program throws an exception - then again you can post here if you don't understand what is going on.

thnka for replying and like i said before , i'm just a newbie so my knowledge about JAVA not much and i'm not a smart guy , so please help me step by step to learn .First thank pbrockway2 , second thank everyone who will help me out .

Quote:

---

Originally Posted by batista11b5

so please help me step by step to learn .

---

Forums are great for answering straightforward questions, but unfortunately, there are some things that a forum is just not good for, and this is one of them since what you really need to learn step by step is to study. The forum can't really substitute for this. So don't give up, keep at it, and then if you run into any roadblocks and have any specific questions, please come on here and ask them.

Best of luck!

Thank Fubarable for replying me , but i really dont know what to go at this line ,I'm not a smart guy so please give me a couple line for example ,Thanks Fubarable so much

Code:

---

import java.io.File;
import java.io.FileNotFoundException;
import javax.swing.JFileChooser;
import java.util.Scanner;

// name of class.
public class QuangNguyenA3Q2 {
        public static void main (String[]args) {


                try {
                Scanner fileReader = new Scanner(getFile());

                // code working with fileReader goes here

               
        [COLOR="Red"][B]What to go there [/B][/COLOR]

                } catch (FileNotFoundException e) {
                e.printStackTrace();
}

        }

        public static File getFile() {
                JFileChooser chooser = new JFileChooser();
                File fastaFile = null;
                int returnValue;

        // show the open file dialog
                returnValue = chooser.showOpenDialog(null);

        // check to see that the user clicked the OK button
                if (returnValue == JFileChooser.APPROVE_OPTION) {
        // get the selected file
                fastaFile = chooser.getSelectedFile();
                }
                return fastaFile;
        }
}

---

One small step at a time. If this were my program, I'd first work on creating this method:

Code:

---

public static String getHeader(File fastaFile) {
  // TODO: add code
}

---

Read your instructions above and try to create this method and then try to test it out. Worry about the rest of the program after you've solved this problem.

thank for your replying , but i got a problem here :when I change String to void it compile completely but when i keep String statement , It can't ,look at the RED one ,please help tell me why ,Thanks
+And how to remove this symbol " > " like the assignment said , Many thanks

Code:

---

import java.io.File;
import java.io.FileNotFoundException;
import javax.swing.JFileChooser;
import java.util.Scanner;

// name of class.
public class QuangNguyenA3Q2 {
        public static void main (String[]args) {
                File fastaFile;
                String x;
                fastaFile = getFile();


                try {
                Scanner fileReader = new Scanner(getFile());

                // code working with fileReader goes here


                        x = fileReader.nextLine();
                        System.out.println(x);

                } catch (FileNotFoundException e) {
                e.printStackTrace();
}

        }

        public static File getFile() {
                JFileChooser chooser = new JFileChooser();
                File fastaFile = null;
                int returnValue;

        // show the open file dialog
                returnValue = chooser.showOpenDialog(null);

        // check to see that the user clicked the OK button
                if (returnValue == JFileChooser.APPROVE_OPTION) {
        // get the selected file
                fastaFile = chooser.getSelectedFile();
                }
                return fastaFile;
        }
        public static [COLOR="Red"][SIZE="5"]void[/SIZE][/COLOR] getHeader(File fastaFile) {
                int lineNumber = 1;
                                String currLine;
                                try {
                                        Scanner fileReader = new Scanner(fastaFile);
                                        // your code working with fileReader goes here

                                        while (fileReader.hasNextLine()) {
                                                currLine = fileReader.nextLine();
                                                System.out.println(lineNumber + " " + currLine);
                                                lineNumber++;
                                        }

                                } catch (FileNotFoundException e) {
                                        e.printStackTrace();
                }

        }

}

---

void means that the method returns nothing, but when you make the method's return type String, then it must return a String, and your method body doesn't do that. For instance, check out the good and bad method below:

Code:

---

public static String goodMethod() {
  return "foo"; // this returns a String
}

public static String badMethod() {
  // this one doesn't but should
}

---

So your getHeader method needs to extract the header String from the file, and then return that String. Make sense?

Thank you , i got it and compile completely ,but i dont know how to how to remove this symbol " > " like the assignment said , Many thanks

Since you know that it is the first character of the String, you could do this pretty easily using String's subString method. Have a look at it in the String API: subString method

HI Fubarable ,I can't execute it , WHat can i do now ?

Code:

---

import java.io.File;
import java.io.FileNotFoundException;
import javax.swing.JFileChooser;
import java.util.Scanner;

// name of class.
public class QuangNguyenA3Q2 {
        public static void main (String[]args) {
                File fastaFile;
                String x;
                fastaFile = getFile();


                try {
                Scanner fileReader = new Scanner(getFile());

                // code working with fileReader goes here


                        x = fileReader.nextLine();
                        System.out.println(x);

                } catch (FileNotFoundException e) {
                e.printStackTrace();
}

        }

        public static File getFile() {
                JFileChooser chooser = new JFileChooser();
                File fastaFile = null;
                int returnValue;

        // show the open file dialog
                returnValue = chooser.showOpenDialog(null);

        // check to see that the user clicked the OK button
                if (returnValue == JFileChooser.APPROVE_OPTION) {
        // get the selected file
                fastaFile = chooser.getSelectedFile();
                }
                return fastaFile;
        }


        public static String getHeader(File fastaFile) {
                int lineNumber = 1;
                [COLOR="Red"][B]String substring = lineNumber.substring(1);[/B][/COLOR]
                                String currLine;

                                try {
                                        Scanner fileReader = new Scanner(fastaFile);
                                        // your code working with fileReader goes here

                                        while (fileReader.hasNextLine()) {
                                                currLine = fileReader.nextLine();
                                                System.out.println([COLOR="Red"][B]substring[/B][/COLOR] + " " + currLine);
                                                lineNumber++;
                                        }

                                } catch (FileNotFoundException e) {
                                        e.printStackTrace();
                }

                        return "foo";
        }

}

---

Quote:

---

Originally Posted by batista11b5

HI Fubarable ,I can't execute it , WHat can i do now ?

---

I don't know. If you are having any errors, you're keeping them secret from us, and so you might want to tell us what they are and in fact post the error messages.

Also, here:

Code:

---

        public static String getHeader(File fastaFile) {
                int lineNumber = 1;
                [COLOR="Red"][B]String substring = lineNumber.substring(1);[/B][/COLOR]
                                String currLine;

                                try {
                                        Scanner fileReader = new Scanner(fastaFile);
                                        // your code working with fileReader goes here

                                        while (fileReader.hasNextLine()) {
                                                currLine = fileReader.nextLine();
                                                System.out.println([COLOR="Red"][B]substring[/B][/COLOR] + " " + currLine);
                                                lineNumber++;
                                        }

                                } catch (FileNotFoundException e) {
                                        e.printStackTrace();
                }

                        return "foo";
        }

}

---

In this method you've got to get out of thinking in terms of println and instead return the actual String of interest. "foo" is not the string of interest, but the String you call substring is. So return it.

Hi Fubarable ,it's still not working and prompt this error

Code:

---

public static String getHeader(File fastaFile) {
                int lineNumber = 1;
                [COLOR="Red"]String substring = lineNumber.substring(1);[/COLOR]

                                String currLine;

                                try {
                                        Scanner fileReader = new Scanner(fastaFile);
                                        // your code working with fileReader goes here

                                        while (fileReader.hasNextLine()) {
                                                currLine = fileReader.nextLine();
                                                System.out.println([COLOR="Red"]substring[/COLOR] + " " + currLine);
                                                lineNumber++;
                                        }

                                } catch (FileNotFoundException e) {
                                        e.printStackTrace();
                }

                        [COLOR="Red"]return substring;[/COLOR]
        }

}

---

error:

Code:

---

C:\Users\k3107q\Desktop\assignment\QuangNguyenA3Q2.java:48: int cannot be dereferenced
                String substring = lineNumber.substring(1);
                                            ^
1 error

Tool completed with exit code 1

---

Your error message is telling you exactly what is wrong. The lineNumber variable is an int variable, and you can't call String methods on an int -- makes no sense. In fact you can't call any methods on primitive variables such as ints.

And this suggests that your logic is broken and needs to be fixed. One key to being successful as a programmer is that you should think through your logic and write it down before commiting code to your program. So what are the steps that you need to take for this method to be successful?

In pseudocode

Code:

---

Pass a file into the method
Create a Scanner object with this file
While the Scanner has a next line, loop
  Get the scanner's next line.
  if the first character of this line == '>'  then  // use the String method charAt(0) to get the first char
      close the Scanner object // don't forget to do this!
      get the line's subString(1) and return it! // once we've found our String we can call return since there's no need to keep looping through the file.
  end if
end while the scanner...

---

+Thank Fubarable for helping me a lot, i have to say that i'm not talent at programming and the programmer title not for me ,I have no ability to get that title , and I just tried this course for 2 months . And I recognized that it not appropriate for me But i have to try to pass this course ,so that's why I asked you a lot , please understand .

+following your explaining for me , I still not get it ,please give me an example code for easier ,many thanks

Anyone help me , i got stuck at this point

Code:

---

public static void printDNAHistogram(String header, int aPct, int
cPct, int gPct, int tPct)

---

The printDNAHistogram method should print out the histogram for the result calculated by
other methods. The printDNAHistogram method should first print out header, and then it should
call the printBar method (described below) for each of aPct, cPct, gPct, and tPct.

Code:

---

public static void printBar(String label, int percent, char barSymbol)

---

The printBar method should print out a single bar for a histogram. The printBar method
should first print out label. Then, the method should print out percent copies of the symbol
barSymbol. Finally, the method should print out the actual percentage that the bar displays. All of
this information should be on the same line.

For example, the call

Code:

printBar("A",25,'=');

would print out the following line:
Code:

A: ========================= (25%)

This is my work .

Code:

---

import java.io.File;
import java.io.FileNotFoundException;
import java.util.Scanner;

import javax.swing.JFileChooser;

// name of class.

public class QuangNguyenA3Q2 {

    private static Scanner scanner;
    private static File fastaFile;
    private static JFileChooser chooser;
    private static StringBuilder sb;
    private static int count;

    public static void main(String[] args) {
        getFile();
        if (fastaFile != null) {
                        // print message and get next input
            System.out.printf("%1$s\r\n", getHeader(fastaFile));
            System.out.printf("%1$s\r\n", getSequence(fastaFile));
        } else {
            System.out.println("Invalid FASTA file.");
        }
    }

    public static File getFile() {
                // show the open file dialog
        chooser = new JFileChooser();
        // check to see that the user clicked the OK button
        if (chooser.showOpenDialog(null) == JFileChooser.APPROVE_OPTION) {
                // get the selected file
            fastaFile = chooser.getSelectedFile();
            return fastaFile;
        }

        return null;
    }

    public static String getHeader(File file) {
        if (file != null) {
            try {
                scanner = new Scanner(file);
                // your code working with fileReader goes here
                return scanner.nextLine().substring(1,
                        scanner.nextLine().length() - 1);
            } catch (FileNotFoundException fnf) {
                fnf.printStackTrace();
            } finally {
                if (scanner != null) {
                    scanner.close();
                }
            }
        }

        return null;
    }
        //the getSequence method should skip the first line contained in fastaFile.
    public static String getSequence(File file) {
        if (file != null) {
            try {
                sb = new StringBuilder();
                scanner = new Scanner(file);
                        // your code working with fileReader goes here.
                while (scanner.hasNextLine()) {
                    if (!scanner.nextLine().contains(">")) {
                        sb.append(scanner.nextLine());
                    }
                }

                return sb.toString();
            } catch (FileNotFoundException fnf) {
                fnf.printStackTrace();
            } finally {
                if (scanner != null) {
                    scanner.close();
                }
            }
        }

        return null;
    }
        //accepts sequence data (a String containing only As, Cs, Gs, and Ts),
    public static int countBase(String sequence, char base) {
        for (int i = 0; i < sequence.length(); i++) {
            if (sequence.charAt(i) == base) {
                count++;
            }
        }

        return count;
    }

}

---

Quote:

---

Originally Posted by batista11b5

Anyone help me , i got stuck at this point

---

What happen? What error did you get? Is it compile or runtime error?

Quote:

---

Originally Posted by batista11b5

Anyone help me , i got stuck at this point

public static File getFile() {
// show the open file dialog
chooser = new JFileChooser();
// check to see that the user clicked the OK button
if (chooser.showOpenDialog(null) == JFileChooser.APPROVE_OPTION) {
// get the selected file
fastaFile = chooser.getSelectedFile();
return fastaFile;
}

return null;
}
[/CODE]

---

I think fubarable already told you this. Your getFile() method should return a File if user input a valid file, you only return null if the file is invalid or and error occured such as FileNotFound. Same as your getHeader(File file) and getSequence(File file) they always return null.